###################################################
### chunk number 1:  eval=FALSE
###################################################
## library(GeneR)
## s <- "gtcatgcatgctaggtgacagttaaaatgcgtctaggtgacagtctaacaa"
## s2 <- insertSeq(s,"aaaaaaaaaaaaaa",20) 
## s2


###################################################
### chunk number 2:  eval=FALSE
###################################################
## library(GeneR)
## strComp(s)


###################################################
### chunk number 3:  eval=FALSE
###################################################
## strCompoSeq(s2,wsize=1)
## 
## strCompoSeq(s2,wsize=2)


###################################################
### chunk number 4:  eval=FALSE
###################################################
## seqNcbi("BY608190",file='toto.fa')
## strReadFasta('toto.fa',from=10,to=35)


###################################################
### chunk number 5:  eval=FALSE
###################################################
## readFasta('toto.fa')
## readFasta('toto.fa',seqno=1)


###################################################
### chunk number 6:  eval=FALSE
###################################################
## getSeq(from=10,to=35)


###################################################
### chunk number 7:  eval=FALSE
###################################################
## getSeq(seqno=0,from=c(1,10,360),to=c(10,20,0))
## assemble(seqno=0,destSeqno=1,from=c(1,10,360),to=c(10,20,0))
## getSeq(seqno=1)


###################################################
### chunk number 8:  eval=FALSE
###################################################
## sizeSeq(seqno=0)
## size0 <- sizeSeq(seqno=0)
## getSeq(seqno=0,from=size0-20,to=0)


###################################################
### chunk number 9:  eval=FALSE
###################################################
## getSeq(0,from=1,to=35)
## getSeq(1)
## appendSeq(0,1)
## getSeq(seqno=0,from=size0-20,to=size0+10)
## 
## concat(seqno1=0,seqno2=1,destSeqno=3, from1=2,to1=10,from2=8,to2=0, strand1=1)
## getSeq(3)


###################################################
### chunk number 10:  eval=FALSE
###################################################
## exactWord("AAAG",seqno=0)


###################################################
### chunk number 11:  eval=FALSE
###################################################
## getOrfs(seqno=0)
## maxOrf(seqno=0)
## 


###################################################
### chunk number 12:  eval=FALSE
###################################################
## x=c(5,15,30);y=c(10,20,35)
## lowerSeq(from=x,to=y)
## getSeq(from=1,to=35)


###################################################
### chunk number 13:  eval=FALSE
###################################################
## posMaskedSeq(seqno=0,type="lower")
## posMaskedSeq(seqno=0,type="upper")


###################################################
### chunk number 14:  eval=FALSE
###################################################
## s <- "ATGCtgTGTTagtacATNNNNNNNNNNNNNNNTGGGTTTaAAAattt"
## placeString(s,upper=FALSE,seqno=0)
## posMaskedSeq(seqno=0,type="N")


###################################################
### chunk number 15:  eval=FALSE
###################################################
## dnaToRna()
## getSeq()


###################################################
### chunk number 16:  eval=FALSE
###################################################
## s <- "xxxxxxxxxxATGTGTCGTTAATTGxxxxxxxxxxxxxxx"
## placeString(s)
## setStrand(0)
## writeFasta(file="toto.fa")
## readFasta(file="toto.fa",from=11,to=25)
## getSeq()


###################################################
### chunk number 17:  eval=FALSE
###################################################
## getOrfs()
## AtoT(getOrfs())


###################################################
### chunk number 18:  eval=FALSE
###################################################
## getSeq()
## exactWord(word="AA")
## AtoT(exactWord(word="AA")[[1]])
## 
## setStrand(1)
## getSeq()
## exactWord(word="AA")
## AtoT(exactWord(word="AA")[[1]])
## exactWord(word="TT")
## AtoT(exactWord(word="TT")[[1]])


###################################################
### chunk number 19:  eval=FALSE
###################################################
## seqNcbi("BY608190",file="bank.fa")
## seqNcbi("BY608190",file="BY608190.gbk",type="genbank")
## 
## #seqSrs("embl|BY608190|BY608190",file="BY608190.embl",submotif=TRUE)


###################################################
### chunk number 20:  eval=FALSE
###################################################
## setStrand(0)
## seqNcbi("BY608190",file="bank.fa")
## seqNcbi("BY608190",file="BY608190.gbk",type="genbank")
## 
## #seqSrs("embl|BY608190|BY608190",file="BY608190.embl",submotif=TRUE)


###################################################
### chunk number 21:  eval=FALSE
###################################################
## readFasta(file="bank.fa",
##           name="gi|26943372|gb|BY608190.1|BY608190",
##           from=1,to=30)
## getSeq()
## fastaDescription(file="bank.fa",
##                  name="gi|26943372|gb|BY608190.1|BY608190")


###################################################
### chunk number 22:  eval=FALSE
###################################################
## s="cgtagctagctagctagctagctagctagcta"
## placeString(s,seqno=0)
## writeFasta(seqno=0,file="bank.fa",name="MySequence",
##            comment="A sequence Generated by R",append=TRUE)
## 
## ## Show bank file
## cat(paste(readLines("bank.fa"),collapse='\n'))


###################################################
### chunk number 23:  eval=FALSE
###################################################
## #     readEmbl(file='BY608190.embl',name='BY608190',from=10,to=30)
## #     getSeq()
## 
##      s<-"gtcatgcatcctaggtgtcagggaaaatgcgtctacgtgacagtctaacaa"
##      placeString(s)
## 
##      # Add lines with "CC   bla bla bla" and a line "XX"
##      writeEmblComment(file="toto.embl",code="CC",text="This is a comment for \
##      this dummy sequence... I try to be long enough to show that this comment \
##      will be written on several lines",append=FALSE)
## 
##      # Add a line with "FT  CDS  bla bla bla"
##      writeEmblLine(file="toto.embl",code="FT",header="CDS",text="<1..12",
##                    nextfield = FALSE)
##      # Add lines with "FT       bla bla bla"
##      writeEmblLine(file="toto.embl",code="FT",header="",text="/codon_start=2",
##                    nextfield = FALSE)
##      writeEmblLine(file="toto.embl",code="FT",header="",text="/gene=\"toto\"",
##                    nextfield = FALSE)
##      writeEmblLine(file="toto.embl",code="FT",header="",text="/note=\"Here is \
##      what I think about this gene\"",nextfield = TRUE)
## 
##      ## Translation
##      prot <- translate(seqno=0,from=getOrfs()[1,1],to=getOrfs()[1,2])
##      writeEmblLine (file="toto.embl",code='FT',header='',
##                     text=paste('/translation="',prot ,'\"',
##                     sep=''),nextfield =FALSE)
## 
##      # Add sequence
##      writeEmblSeq(file="toto.embl")
## 
##      ## Show file
##      cat(paste(readLines("toto.embl"),collapse='\n'))


###################################################
### chunk number 24:  eval=FALSE
###################################################
##      readGbk(file='BY608190.gbk',name='BY608190',from=10,to=30)
##      getSeq()


###################################################
### chunk number 25:  eval=FALSE
###################################################
## a = matrix(c(1,5,15,45,17,38,
##              100,120,130,140,
##              135,145,142,160),
##              ncol=2,byrow=TRUE)
## b  = matrix(c(15,18, 28,45,
##               1,10, 15,20, 25,40,
##               17,23, 35,38,100,105,
##               110,120),ncol=2,byrow=TRUE)
## 
## a <- as.segSet(a)
## b <- as.segSet(b)
## 
## A = list(
##          matrix( c( 1, 15, 17,  5, 45, 38),ncol=2),
##          matrix( c( 100 , 120),ncol=2),
##          matrix( c( 130, 135, 140, 145),ncol=2),
##          matrix( c( 142 , 160),ncol=2))
## 
## B = list(
##          matrix( c(15, 28, 18, 45),ncol=2),
##          matrix( c(1, 15, 25, 10, 20, 40),ncol=2),
##          matrix( c(17, 35, 23, 38),ncol=2),
##          matrix( c(100, 110, 105, 120),ncol=2))
## 
## A = as.globalSeg(A)
## B = as.globalSeg(B)
## 
## 
## c = or(a,b)
## d = and(a,b)
## e = not(a,b)
## f = Xor(a,b)
## par(mfrow=c(4,1))
## ##par(mfrow=c(2,1))
## plot(a,xlim=c(1,160),main="a (segSet)")
## plot(b,xlim=c(1,160),main="b (segSet)")
## plot(A,xlim=c(1,160),main="A (globalSet)")
## plot(B,xlim=c(1,160),main="B (globalSet)")


###################################################
### chunk number 26:  eval=FALSE
###################################################
## g = or(a)
## h = and(a)
## #i = not(a)
## #j = Xor(a)
## 
## C = or(A,B)
## D = and(A,B)
## E = not(A,B)
## F0 = Xor(A,B)
## G = or(A)
## H = and(A)
## #I = not(A)
## #J = Xor(A)
## 
## par(mfrow=c(4,1))
## ##par(mfrow=c(2,1))
## plot(c,xlim=c(1,160),main="a or b")
## plot(d,xlim=c(1,160),main="a and b")
## plot(e,xlim=c(1,160),main="a not b")
## plot(f,xlim=c(1,160),main="a Xor b")


###################################################
### chunk number 27:  eval=FALSE
###################################################
## par(mfrow=c(4,1))
## ##par(mfrow=c(2,1))
## plot(C,xlim=c(1,160),main="A or B")
## plot(D,xlim=c(1,160),main="A and B")
## plot(E,xlim=c(1,160),main="A not B")
## plot(F0,xlim=c(1,160),main="A Xor B")


###################################################
### chunk number 28:  eval=FALSE
###################################################
## par(mfrow=c(4,1))
## ##par(mfrow=c(2,1))
## plot(G,xlim=c(1,160),main="or A")
## plot(H,xlim=c(1,160),main="and A")
## #plot(I,xlim=c(1,160),main="not A")
## #plot(J,xlim=c(1,160),main="Xor A")
## 
## plot(g,xlim=c(1,160),main="or a")
## ##plot.segSet(h,xlim=c(1,160),main="and a")
## #plot(i,xlim=c(1,160),main="not a")
## #plot(j,xlim=c(1,160),main="Xor a")


###################################################
### chunk number 29:  eval=FALSE
###################################################
## ## Set seed of your choice (not requiered)
## set.seed(3)
## 
## ####  ----  RANDOMSEQ  ----
## ## Create a sequence of size 30, GC rich
## randomSeq(prob = c(0.20, 0.30, 0.20, 0.30), 
##                  letters = c("T", "C","A", "G"), n = 30)
## ## [1] "CTGGAACCGAGGGGTTCATCCCCCCAGTGA"
## 
## ## use with bi-nucleotides
## randomSeq(prob=rep(0.0625,16),letters = c("TT","TC","TA","TG",
##           "CT","CC","CA","CG","AT","AC","AA","AG","GT","GC","GA","GG"),n=10)
## ## [1] "CGCATGATCCCAGGCTAACT"
## 
## ####  ----  SHUFFLESEQ  ----
## ## Create a sequence with 7 T, 3 C and A, and 4 G.
## shuffleSeq(count=c(7,3,3,4,0),letters=c("T","C","A","G","N"))
## ## [1] "TATCTTTTGTCGGACGA"
## 
## ## Same with bi-nucleotides
## shuffleSeq(count=c(rep(4,4),rep(2,4),rep(1,4),rep(0,4)),
##            letters = c("TT","TC","TA","TG","CT","CC","CA",
##                        "CG","AT","AC","AA","AG","GT","GC","GA","GG"))
## ## [1] "TCTTTCCATTCCTTCTAGTGTACCCGTATACGTGTCTGTGTACTTCAACAACTTAT"
## 
## 
## ## From a real sequence:
## seqNcbi("BY608190",file="BY608190.fa")
## readFasta("BY608190.fa")
## 
## ## create a random sequence from a real tri-nucleotides distribution
## ## Size of sequence will be 10*3.
## randomSeq(compoSeq(wsize=3,p=TRUE),n=10)
## 
## ## re assemble real tri-nucleotides of a real sequence
## shuffleSeq(compoSeq(wsize=3,from=1,to=30,p=FALSE))


###################################################
### chunk number 30:  eval=FALSE
###################################################
##   ## We create a sequence with a biais every 100 nucleotides
##   s <- ""
##   for(i in 1:20)
##      s <- paste(s, randomSeq(n=100),randomSeq(prob=c(0.3,1,1,1,0)/3.3,n=100),sep="")
##  
##   placeString(s,seqno=0)
## 
##   dens <- densityProfile(ori=200*(1:20)-100,from=200*(0:19)+1,to=200*(1:20),
##               seqno=0, fun=seqSkew,nbinL=10,nbinR=10,sizeBin=10)
## 
## 
##   plot(dens$skta,main="TA skew")
## 
##   ## Example with flagged 'N'
## 
##   ## We create a sequence with a biais every 100 nucleotides
##   s <- ""
##   for(i in 1:20)
##      s <- paste(s, randomSeq(n=100),randomSeq(prob=c(0.3,1,1,1,0.2)/3.5,n=100),sep="")
##  
##   placeString(s,seqno=1)
## 
##   dens2 <- densityProfile(ori=200*(1:20)-100,from=200*(0:19)+1,to=200*(1:20),
##               seqno=1, fun=compoSeq,nbinL=10,nbinR=10,sizeBin=10)
## 
##   plot(dens2$T,main="#T")
## 
##   ## The same but more permissive (allow 4 N in each bin)
## 
##   dens3 <- densityProfile(ori=200*(1:20)-100,from=200*(0:19)+1,to=200*(1:20),
##               seqno=1, fun=compoSeq,nbinL=10,nbinR=10,sizeBin=10,threshold=4)
## 
##   plot(dens3$T,main="#T")