\name{complementSeq} \alias{complementSeq} \title{Complementary sequence.} \description{ WARNING: \code{complementSeq} has been deprecated in favor of \code{\link{complement}}. Function to obtain the complementary sequence. } \usage{ complementSeq(seq, start=1, stop=0) } \arguments{ \item{seq}{Character vector consisting of the letters A, C, G and T.} \item{start}{Numeric scalar: the sequence position at which to start complementing. If 1, start from the beginning.} \item{stop}{Numeric scalar: the sequence position at which to stop complementing. If 0, go until the end.} } \details{ The complemented sequence for each element of the input is computed and returned. The complement is given by the mapping: A -> T, C -> G, G -> C, T -> A. An important special case is \code{start=13}, \code{stop=13}: If \code{seq} is a vector of 25mer sequences on an Affymetrix GeneChip, \code{complementSeq(seq, start=13, stop=13)} calculates the so-called \emph{mismatch} sequences. The function deals only with sequences that represent DNA. These can consist only of the letters \code{A}, \code{C}, \code{T} or \code{G}. Upper, lower or mixed case is allowed and honored. } \value{ A character vector of the same length as \code{seq} is returned. Each component represents the transformed sequence for the input value. } \author{R. Gentleman, W. Huber} \seealso{\code{\link{alphabetFrequency}}, \code{\link{reverseComplement}}} \examples{ ## --------------------------------------------------------------------- ## EXAMPLE 1 ## --------------------------------------------------------------------- seq <- c("AAACT", "GGGTT") ## Don't do this anymore (deprecated): if (interactive()) { complementSeq(seq) # inefficient on large vectors } ## But do this instead: complement(DNAStringSet(seq)) # more efficient ## --------------------------------------------------------------------- ## EXAMPLE 2 ## --------------------------------------------------------------------- seq <- c("CGACTGAGACCAAGACCTACAACAG", "CCCGCATCATCTTTCCTGTGCTCTT") ## Don't do this anymore (deprecated): if (interactive()) { complementSeq(seq, start=13, stop=13) } ## But do this instead: pm2mm <- function(probes) { probes <- DNAStringSet(probes) subseq(probes, start=13, end=13) <- complement(subseq(probes, start=13, end=13)) probes } pm2mm(seq) ## --------------------------------------------------------------------- ## SPEED OF complementSeq() VS complement() ## --------------------------------------------------------------------- if (interactive()) { library(hgu95av2probe) system.time(y1 <- complementSeq(hgu95av2probe$sequence)) probes <- DNAStringSet(hgu95av2probe$sequence) system.time(y2 <- complement(probes)) } } \keyword{manip}